ClinVar Genomic variation as it relates to human health
NM_000240.3(MAOA):c.-1241ACCGGCACCGGCACCAGTACCCGCACCAGT[3_5]
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000240.3(MAOA):c.-1241ACCGGCACCGGCACCAGTACCCGCACCAGT[3_5]
Variation ID: 9968 Accession: VCV000009968.2
- Type and length
-
Microsatellite, -
- Location
-
Cytogenetic: Xp11.3 X: 43655101-43655130 (GRCh38) [ NCBI UCSC ] X: 43514349-43514378 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 15, 2018 Oct 7, 2023 Apr 1, 2011 - HGVS
-
Nucleotide Protein Molecular
consequenceNG_008957.1:g.3941ACCGGCACCGGCACCAGTACCCGCACCAGT[3_5] - Protein change
- Other names
- MAOA-uVNTR
- Canonical SPDI
- -
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Comment on variant
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MAOA | Little evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
169 | 326 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
risk factor (1) |
no assertion criteria provided
|
Apr 1, 2011 | RCV000010646.6 | |
Pathogenic (1) |
no assertion criteria provided
|
Apr 1, 2011 | RCV000010647.6 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Apr 01, 2011)
|
no assertion criteria provided
Method: literature only
|
AUTISM, SEVERE
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000030873.6
First in ClinVar: Apr 04, 2013 Last updated: Oct 07, 2023 |
Comment on evidence:
Sabol et al. (1998) identified a polymorphism 1.2 kb upstream of the MAOA coding sequences that consists of a 30-bp repeated sequence present in 3, … (more)
Sabol et al. (1998) identified a polymorphism 1.2 kb upstream of the MAOA coding sequences that consists of a 30-bp repeated sequence present in 3, 3.5, 4, or 5 copies (3R, 3.5R, 4R, and 5R, respectively). The polymorphism was in linkage disequilibrium with other MAOA and MAOB (309860) gene markers and displayed significant variation in allele frequency across ethnic groups. The polymorphism was shown to affect transcriptional activity of the MAOA gene promoter by gene fusion and transfection experiments involving 3 different cell types. Alleles with 3.5 or 4 copies of the repeat sequence are transcribed 2 to 10 times more efficiently than those with 3 or 5 copies of the repeat, suggesting an optimal length for the regulatory region. Cohen et al. (2003) referred to this polymorphism as MAOA-uVNTR (for the upstream variable-number tandem repeat region). Autism Cohen et al. (2003) examined the relation between this promoter polymorphism and the phenotypic expression of autism (see 209850) in 41 males younger than 12.6 years of age. Children with the low-activity MAOA allele had both lower IQs and more severe autistic behavior than children with the high-activity allele. In follow-up testing of 34 of the males at the 1 year time-point, those with the low-activity allele showed a worsening in IQ but no change in the severity of their autistic behavior. Cohen et al. (2003) concluded that functional MAOA-uVNTR alleles may act as a genetic modifier of the severity of autism in males. Cohen et al. (2011) presented evidence suggesting that autism severity is associated with child and maternal MAOA genotypes. Among 119 boys with autism, those with the low activity 3-repeat MAOA allele had more severe sensory behaviors, arousal regulation problems, aggression, and worse social communication skills than males with the high activity 4-repeat allele. These findings replicated those of Cohen et al. (2003). Boys with the 3R allele were less affected by maternal genotype than those with the 4R allele. Boys with the 4R allele born of heterozygous 3R/4R mothers were the least affected overall, with greater social communication skills, fewer problem behaviors, and the lowest mean scores for autism. Boys with the 4R allele born of homozygous 4R/4R mothers presented as a high-functioning group, although with excessive anxiety-mediated problems and high levels of irritability. These findings indicated the importance of considering maternal genotype in examining associations of MAOA and other genes with behavior in male offspring. Antisocial Behavior, Susceptibility to Caspi et al. (2002) studied a population of 1,037 children, 52% of whom were male, who had been assessed from birth through age 26 years. Between the ages of 3 and 11 years, 8% of the study children experienced severe maltreatment, 28% experienced probable maltreatment, and 64% experienced no maltreatment. Caspi et al. (2002) found that those with low MAOA activity were much more likely to develop antisocial behavior, conduct disorder, a disposition toward violent behavior, or conviction for violent offense than were those with high MAOA activity. Passamonti et al. (2006) studied the relationship between the MAOA VNTR polymorphism and brain activity elicited by a response inhibition task (go/no go task) using blood oxygenation level-dependent (BOLD) functional MRI in 24 healthy men. Direct comparison between groups revealed a greater BOLD response in the right ventrolateral prefrontal cortex (Brodmann's area (BA) 45 and 47) in high-activity allele carriers, whereas a greater response in the right superior parietal cortex (BA 7) and bilateral extrastriate cortex (BA 18) was found in low-activity allele carriers, suggesting that a specific genetic variation involving serotonergic catabolism can modulate BOLD response associated with human impulsivity. In a large sample of healthy volunteers, Meyer-Lindenberg et al. (2006) found that those with the low-expression MAOA polymorphism (MAOA-L; 2R, 3R, or 5R) showed an approximately 8% decrease of gray matter volumes in the cingulate gyrus and amygdala, as well as the insula and hypothalamus, compared to those with the high-expression polymorphism (MAOA-H; 3.5R or 4R). MAOA-L males had an approximately 14% increase in volumes in the lateral orbitofrontal cortex compared to MAOA-H males; no such difference in this area was seen in women, suggesting a sex-by-genotype interaction. Functional MRI studies during emotional arousal showed that MAOA-L carriers demonstrated increased amygdala arousal as well as diminished reactivity of regulatory prefrontal regions compared to MAOA-H carriers. Studies of aversive emotional memory retrieval showed that male, but not female, MAOA-L carriers had increased activity in the amygdala and hippocampus and impaired cingulate activation during cognitive inhibition compared to MAOA-H carriers. The findings suggested that sex- and genotype-specific differences in limbic circuitry for emotion regulation and cognitive control may be involved in the association of MAOA with impulsive aggression and/or violence. Among 2,524 participants in a longitudinal study of delinquent behavior in adolescence and young adulthood, Guo et al. (2008) found a significant association between the rare MAOA*2R polymorphism and serious delinquency and violent delinquency. Men with the MAOA*2R variant had about twice the levels of delinquency compared to those with the other MAOA promoter variants. The results for women were similar, but weaker. In vitro functional expression studies in human brain-derived cell lines showed that the 2R promoter exhibited much lower levels of promoter activity than the 3R or 4R promoters, with about 25 to 30% of activity exhibited by the 4R promoter. In a behavioral experiment in which male subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent, McDermott et al. (2009) found that those with the MAOA-L genotype were more likely to act aggressively than those with the MAOA-H genotype. The association was significant when the amount of money taken was higher (high provocative situation), suggesting an environmental interaction. The findings suggested that individual variance in genetic factors may contribute to everyday behaviors and decisions. For discussions of genetic contributions to similar phenotypes, see also COMT (116790.0001) and HTR2B (601122). (less)
|
|
risk factor
(Apr 01, 2011)
|
no assertion criteria provided
Method: literature only
|
ANTISOCIAL BEHAVIOR, SUSCEPTIBILITY TO
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000030872.6
First in ClinVar: Apr 04, 2013 Last updated: Oct 07, 2023 |
Comment on evidence:
Sabol et al. (1998) identified a polymorphism 1.2 kb upstream of the MAOA coding sequences that consists of a 30-bp repeated sequence present in 3, … (more)
Sabol et al. (1998) identified a polymorphism 1.2 kb upstream of the MAOA coding sequences that consists of a 30-bp repeated sequence present in 3, 3.5, 4, or 5 copies (3R, 3.5R, 4R, and 5R, respectively). The polymorphism was in linkage disequilibrium with other MAOA and MAOB (309860) gene markers and displayed significant variation in allele frequency across ethnic groups. The polymorphism was shown to affect transcriptional activity of the MAOA gene promoter by gene fusion and transfection experiments involving 3 different cell types. Alleles with 3.5 or 4 copies of the repeat sequence are transcribed 2 to 10 times more efficiently than those with 3 or 5 copies of the repeat, suggesting an optimal length for the regulatory region. Cohen et al. (2003) referred to this polymorphism as MAOA-uVNTR (for the upstream variable-number tandem repeat region). Autism Cohen et al. (2003) examined the relation between this promoter polymorphism and the phenotypic expression of autism (see 209850) in 41 males younger than 12.6 years of age. Children with the low-activity MAOA allele had both lower IQs and more severe autistic behavior than children with the high-activity allele. In follow-up testing of 34 of the males at the 1 year time-point, those with the low-activity allele showed a worsening in IQ but no change in the severity of their autistic behavior. Cohen et al. (2003) concluded that functional MAOA-uVNTR alleles may act as a genetic modifier of the severity of autism in males. Cohen et al. (2011) presented evidence suggesting that autism severity is associated with child and maternal MAOA genotypes. Among 119 boys with autism, those with the low activity 3-repeat MAOA allele had more severe sensory behaviors, arousal regulation problems, aggression, and worse social communication skills than males with the high activity 4-repeat allele. These findings replicated those of Cohen et al. (2003). Boys with the 3R allele were less affected by maternal genotype than those with the 4R allele. Boys with the 4R allele born of heterozygous 3R/4R mothers were the least affected overall, with greater social communication skills, fewer problem behaviors, and the lowest mean scores for autism. Boys with the 4R allele born of homozygous 4R/4R mothers presented as a high-functioning group, although with excessive anxiety-mediated problems and high levels of irritability. These findings indicated the importance of considering maternal genotype in examining associations of MAOA and other genes with behavior in male offspring. Antisocial Behavior, Susceptibility to Caspi et al. (2002) studied a population of 1,037 children, 52% of whom were male, who had been assessed from birth through age 26 years. Between the ages of 3 and 11 years, 8% of the study children experienced severe maltreatment, 28% experienced probable maltreatment, and 64% experienced no maltreatment. Caspi et al. (2002) found that those with low MAOA activity were much more likely to develop antisocial behavior, conduct disorder, a disposition toward violent behavior, or conviction for violent offense than were those with high MAOA activity. Passamonti et al. (2006) studied the relationship between the MAOA VNTR polymorphism and brain activity elicited by a response inhibition task (go/no go task) using blood oxygenation level-dependent (BOLD) functional MRI in 24 healthy men. Direct comparison between groups revealed a greater BOLD response in the right ventrolateral prefrontal cortex (Brodmann's area (BA) 45 and 47) in high-activity allele carriers, whereas a greater response in the right superior parietal cortex (BA 7) and bilateral extrastriate cortex (BA 18) was found in low-activity allele carriers, suggesting that a specific genetic variation involving serotonergic catabolism can modulate BOLD response associated with human impulsivity. In a large sample of healthy volunteers, Meyer-Lindenberg et al. (2006) found that those with the low-expression MAOA polymorphism (MAOA-L; 2R, 3R, or 5R) showed an approximately 8% decrease of gray matter volumes in the cingulate gyrus and amygdala, as well as the insula and hypothalamus, compared to those with the high-expression polymorphism (MAOA-H; 3.5R or 4R). MAOA-L males had an approximately 14% increase in volumes in the lateral orbitofrontal cortex compared to MAOA-H males; no such difference in this area was seen in women, suggesting a sex-by-genotype interaction. Functional MRI studies during emotional arousal showed that MAOA-L carriers demonstrated increased amygdala arousal as well as diminished reactivity of regulatory prefrontal regions compared to MAOA-H carriers. Studies of aversive emotional memory retrieval showed that male, but not female, MAOA-L carriers had increased activity in the amygdala and hippocampus and impaired cingulate activation during cognitive inhibition compared to MAOA-H carriers. The findings suggested that sex- and genotype-specific differences in limbic circuitry for emotion regulation and cognitive control may be involved in the association of MAOA with impulsive aggression and/or violence. Among 2,524 participants in a longitudinal study of delinquent behavior in adolescence and young adulthood, Guo et al. (2008) found a significant association between the rare MAOA*2R polymorphism and serious delinquency and violent delinquency. Men with the MAOA*2R variant had about twice the levels of delinquency compared to those with the other MAOA promoter variants. The results for women were similar, but weaker. In vitro functional expression studies in human brain-derived cell lines showed that the 2R promoter exhibited much lower levels of promoter activity than the 3R or 4R promoters, with about 25 to 30% of activity exhibited by the 4R promoter. In a behavioral experiment in which male subjects paid to punish those they believed had taken money from them by administering varying amounts of unpleasantly hot (spicy) sauce to their opponent, McDermott et al. (2009) found that those with the MAOA-L genotype were more likely to act aggressively than those with the MAOA-H genotype. The association was significant when the amount of money taken was higher (high provocative situation), suggesting an environmental interaction. The findings suggested that individual variance in genetic factors may contribute to everyday behaviors and decisions. For discussions of genetic contributions to similar phenotypes, see also COMT (116790.0001) and HTR2B (601122). (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Autism severity is associated with child and maternal MAOA genotypes. | Cohen IL | Clinical genetics | 2011 | PMID: 20573161 |
Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation. | McDermott R | Proceedings of the National Academy of Sciences of the United States of America | 2009 | PMID: 19168625 |
The VNTR 2 repeat in MAOA and delinquent behavior in adolescence and young adulthood: associations and MAOA promoter activity. | Guo G | European journal of human genetics : EJHG | 2008 | PMID: 18212819 |
Neural mechanisms of genetic risk for impulsivity and violence in humans. | Meyer-Lindenberg A | Proceedings of the National Academy of Sciences of the United States of America | 2006 | PMID: 16569698 |
Monoamine oxidase-a genetic variations influence brain activity associated with inhibitory control: new insight into the neural correlates of impulsivity. | Passamonti L | Biological psychiatry | 2006 | PMID: 16202396 |
Association of autism severity with a monoamine oxidase A functional polymorphism. | Cohen IL | Clinical genetics | 2003 | PMID: 12919132 |
Role of genotype in the cycle of violence in maltreated children. | Caspi A | Science (New York, N.Y.) | 2002 | PMID: 12161658 |
A functional polymorphism in the monoamine oxidase A gene promoter. | Sabol SZ | Human genetics | 1998 | PMID: 9799080 |
Text-mined citations for rs1346551029 ...
HelpRecord last updated Dec 30, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.
MAOA promoter 30-nt repeat